| Internal ID | 17780135 | Source Database | TransTermHP TERM 44 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 44
|
| Sequence |
CGGGGCCCGTCCTGGGCCCCG Look for more occurrences |
| Start | 112658 |
| End | 112678 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas vranovensis DSM 16006 H621DRAFT_scaffold00007.7, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ACCTGACCCTGTCTG(5' tail) CGGGGCCCG(5' stem) TCC(loop) TGGGCCCCG(3' stem) TTTGCATTTCTGTGG(3' tail). Confidence: 100. overlap 112652 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|