| Internal ID | 17779369 | Source Database | TransTermHP TERM 71 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 71
|
| Sequence |
CAGGGTAGTCCTTTGGGTTGCCCTG Look for more occurrences |
| Start | 226233 |
| End | 226257 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas vranovensis DSM 16006 H621DRAFT_scaffold00002.2_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CAGCACACACAAAAA(5' tail) CAGGGCAACCC(5' stem) AAA(loop) GGACTACCCTG(3' stem) TTCGTCATGACTGAT(3' tail). Confidence: 100. opp_overlap 226233 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|