| Internal ID | 17779231 | Source Database | TransTermHP TERM 12 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 12
|
| Sequence |
GAACGCCGGGCATTGCCCGGCGTTC Look for more occurrences |
| Start | 35592 |
| End | 35616 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas vranovensis DSM 16006 H621DRAFT_scaffold00001.1_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CAAGCGCACACACAA(5' tail) GAACGCCGGGC(5' stem) ATT(loop) GCCCGGCGTTC(3' stem) TTGTGTGTGGCGATC(3' tail). Confidence: 100. opp_overlap 35580 35592 35595, overlap 35589 35595 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|