| Internal ID | 17779227 | Source Database | TransTermHP TERM 8 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 8
|
| Sequence |
GCCGACCCACTTGTGGGTCGGC Look for more occurrences |
| Start | 34457 |
| End | 34478 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas vranovensis DSM 16006 H621DRAFT_scaffold00001.1_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TCGGGCAATAAAAAA(5' tail) GCCGACCCA(5' stem) CAAG(loop) TGGGTCGGC(3' stem) TCCAAATAACAATCC(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|