| Internal ID | 17778715 | Source Database | TransTermHP TERM 72 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 72
|
| Sequence |
GAAACCCGGCCATTCGCCGGGTTTC Look for more occurrences |
| Start | 156413 |
| End | 156437 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas resinovorans DSM 21078 G559DRAFT_scaffold00012.12_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCACCAGCGGTAAGA(5' tail) GAAACCCGGC(5' stem) CATTC(loop) GCCGGGTTTC(3' stem) TTCATATTTGGGCGT(3' tail). Confidence: 93. opp_overlap 156413 156417, overlap 156408 156417 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|