| Internal ID | 17778004 | Source Database | TransTermHP TERM 29 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 29
|
| Sequence |
GCCCCGCCGGCTCGTGCCTGCGGGGC Look for more occurrences |
| Start | 234238 |
| End | 234263 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas parafulva DSM 17004 H619DRAFT_scaffold00001.1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CACCCAGCAAAAAAA(5' tail) GCCCCGCAGGC(5' stem) ACGA(loop) GCCGGCGGGGC(3' stem) AAACGCTGGCTGGAC(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|