| Internal ID | 17772196 | Source Database | TransTermHP TERM 48 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 48
|
| Sequence |
CGTTCCCACGCTCTGCGTGGGAATG Look for more occurrences |
| Start | 120107 |
| End | 120131 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. CFT9 soap_scaffs_T9.Contig61, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGCCCCCACGCTGAT(5' tail) CGTTCCCACGC(5' stem) TCT(loop) GCGTGGGAATG(3' stem) CTGTTTTGGACGCTC(3' tail). Confidence: 90. opp_overlap 120091, overlap 120106 120104 120109 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|