| Internal ID | 17772121 | Source Database | TransTermHP TERM 14 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 14
|
| Sequence |
CGCCGCGTATCGCAAGGTACGCGGCG Look for more occurrences |
| Start | 134135 |
| End | 134160 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. CFT9 soap_scaffs_T9.Contig59, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGTTGATGTGAAAGG(5' tail) CGCCGCGTATC(5' stem) GCAA(loop) GGTACGCGGCG(3' stem) TTTTTTTGCGTGCGC(3' tail). Confidence: 100. opp_overlap 134134 134133 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|