| Internal ID | 17771564 | Source Database | TransTermHP TERM 41 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 41
|
| Sequence |
CGGCTGCCCGCTCGGGCAGCCG Look for more occurrences |
| Start | 239651 |
| End | 239672 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. CFT9 soap_scaffs_T9.Contig9, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCCTCATGCCCACCT(5' tail) CGGCTGCCC(5' stem) GCTC(loop) GGGCAGCCG(3' stem) TTCTTAAAGTCCCGC(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|