| Internal ID | 17770735 | Source Database | TransTermHP TERM 26 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 26
|
| Sequence |
GGGGCCGGTCTTGGGACAGGCCCC Look for more occurrences |
| Start | 79023 |
| End | 79046 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. CFII64 soap_scaffs_II64_half.Contig9, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CAGCAGTAAGCAAAA(5' tail) GGGGCCTGTC(5' stem) CCAA(loop) GACCGGCCCC(3' stem) TTATTCATTGACCCT(3' tail). Confidence: 95. opp_overlap 79023 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|