Internal ID | 17770633 | Source Database | TransTermHP TERM 83 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 83
|
Sequence |
GGGGAGCCAGTGATCTGGCTCCCC Look for more occurrences |
Start | 445961 |
End | 445984 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas sp. CFII64 soap_scaffs_II64_half.Contig2, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CGCTTGAATGAAAAA(5' tail) GGGGAGCCAG(5' stem) ATCA(loop) CTGGCTCCCC(3' stem) TTTTTTGTTACCGAT(3' tail). Confidence: 100. opp_overlap 445961 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|