| Internal ID | 17768619 | Source Database | TransTermHP TERM 68 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 68
|
| Sequence |
CAAACCCGCCAAAAGGCGGGTTTG Look for more occurrences |
| Start | 182043 |
| End | 182066 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. CF149 soap_scaffs_149.Contig36, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GTATCGGTTAAACAA(5' tail) CAAACCCGCC(5' stem) TTTT(loop) GGCGGGTTTG(3' stem) TTGTTTATGACCCTG(3' tail). Confidence: 100. opp_overlap 182040 182043 182047, overlap 182040 182047 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|