| Internal ID | 17766612 | Source Database | TransTermHP TERM 29 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 29
|
| Sequence |
GCCCGCCCGCATTCGTGCTGGCGGGC Look for more occurrences |
| Start | 57828 |
| End | 57853 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. P818 P818-scaffold13, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ACCAGGCAACAAAAA(5' tail) GCCCGCCAGCA(5' stem) CGAA(loop) TGCGGGCGGGC(3' stem) TCTTTCGAACCGTGA(3' tail). Confidence: 100. opp_overlap 57828 57826 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|