| Internal ID | 17763552 | Source Database | TransTermHP TERM 35 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 35
|
| Sequence |
GCCCTGCTCTTGAGCAGGGC Look for more occurrences |
| Start | 184100 |
| End | 184119 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas syringae BRIP39023 genomic scaffold scaffold17, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTGCGCAAACGCAAA(5' tail) GCCCTGCT(5' stem) CTTG(loop) AGCAGGGC(3' stem) TTTTTTTGTCTCCGA(3' tail). Confidence: 100. opp_overlap 184100 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|