| Internal ID | 17760847 |
| Source Database | TransTermHP TERM 98 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 98
|
| Sequence |
CCGCTTCCCTCACTGGAAGCGG Look for more occurrences |
| Start | 366172 |
| End | 366193 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas veronii 1YdBTEX2 Contig5, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CCAGGCATAAAAAAA(5' tail) CCGCTTCC(5' stem) AGTGAG(loop) GGAAGCGG(3' stem) TTTTGTCTACAGCGG(3' tail). Confidence: 100. opp_overlap 366172 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|