| Internal ID | 17760744 | Source Database | TransTermHP TERM 3 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 3
|
| Sequence |
TGCCCGCTTCGTCAGTTGCGGGCA Look for more occurrences |
| Start | 12882 |
| End | 12905 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas stutzeri TS44 Contig00039, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGCTTGAACGAAAAA(5' tail) TGCCCGCAAC(5' stem) TGAC(loop) GAAGCGGGCA(3' stem) TTTTGCGTGACTTGA(3' tail). Confidence: 91. opp_overlap 12882 12875 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|