Internal ID | 17759188 | Source Database | TransTermHP TERM 10 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 10
|
Sequence |
GCTTGGCGTGATCACGCCAAGC Look for more occurrences |
Start | 38645 |
End | 38666 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas sp. S9 Contig11, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCCGGGGGCAACCAG(5' tail) GCTTGGCGT(5' stem) GATC(loop) ACGCCAAGC(3' stem) TGTTCAGCAACGCTG(3' tail). Confidence: 93. opp_overlap 38644 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|