| Internal ID | 17758515 | Source Database | TransTermHP TERM 192 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 192
|
| Sequence |
GCCGGCCCATAATGGGCCGGC Look for more occurrences |
| Start | 586195 |
| End | 586215 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. S9 Contig1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CATCGACAAAAAAAA(5' tail) GCCGGCCCA(5' stem) TAA(loop) TGGGCCGGC(3' stem) TTTCTTTAGCCTGAA(3' tail). Confidence: 100. opp_overlap 586179 586195 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|