Internal ID | 17758513 | Source Database | TransTermHP TERM 190 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 190
|
Sequence |
CCCGTCGCGTGAAACCGGCGGG Look for more occurrences |
Start | 586136 |
End | 586157 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas sp. S9 Contig1, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCTGTGTTGAAGCAA(5' tail) CCCGTCGCGT(5' stem) GAA(loop) AC-CGGCGGG(3' stem) TTTTTATTTGCACTT(3' tail). Confidence: 100. gap 1, opp_overlap 586136 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|