| Internal ID | 17757174 | Source Database | TransTermHP TERM 316 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 316
|
| Sequence |
GGCGGCCTCATCCAGCGCCGCC Look for more occurrences |
| Start | 1391493 |
| End | 1391514 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas taeanensis MS-3 contig_01, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GAAATCAACAAAAAA(5' tail) GGCGGCGCT(5' stem) GGATG(loop) AG-GCCGCC(3' stem) CTCTTTGGGGGAATA(3' tail). Confidence: 100. gap 1, opp_overlap 1391492 1391493 1391506, overlap 1391486 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|