| Internal ID | 17756764 | Source Database | TransTermHP TERM 34 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 34
|
| Sequence |
GGGCCGACATTCGTTGTCGGCCC Look for more occurrences |
| Start | 122247 |
| End | 122269 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas pelagia CL-AP6 111.KCCM90073.1_14, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTCCACCATTACCAA(5' tail) GGGCCGACA(5' stem) TTCGT(loop) TGTCGGCCC(3' stem) TTTTTTTTGGTTTTT(3' tail). Confidence: 100. opp_overlap 122247 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|