Internal ID | 17756736 | Source Database | TransTermHP TERM 7 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 7
|
Sequence |
CACCCCGCCCCGGCGGGGTG Look for more occurrences |
Start | 50704 |
End | 50723 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas pelagia CL-AP6 111.KCCM90073.1_11, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CAGACACAAACAAAA(5' tail) CACCCCGC(5' stem) CGGG(loop) GCGGGGTG(3' stem) TGTTGGAGCAGCAAT(3' tail). Confidence: 100. opp_overlap 50704 50706, overlap 50699 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|