Internal ID | 17756725 | Source Database | TransTermHP TERM 91 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 91
|
Sequence |
GAAGGCGCCAACCGGCGCCTTC Look for more occurrences |
Start | 454590 |
End | 454611 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas pelagia CL-AP6 111.KCCM90073.1_9, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CTCAACCGACAGCAA(5' tail) GAAGGCGCC(5' stem) GGTT(loop) GGCGCCTTC(3' stem) TTCGTTTCCGATACT(3' tail). Confidence: 100. opp_overlap 454587 454590 454593, overlap 454593 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|