| Internal ID | 17756697 | Source Database | TransTermHP TERM 49 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 49
|
| Sequence |
GGCCCGGGCACTCTGTGTCCGGGCTC Look for more occurrences |
| Start | 271802 |
| End | 271827 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas pelagia CL-AP6 111.KCCM90073.1_9, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGTAACGGTAAGTCA(5' tail) G-GCCCGGGCAC(5' stem) TCT(loop) GTGTCCGGGCTC(3' stem) TTCTTTCTAGTTTTA(3' tail). Confidence: 100. gap 1, opp_overlap 271802, overlap 271803 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|