| Internal ID | 17756238 | Source Database | TransTermHP TERM 4 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 4
|
| Sequence |
CCTCGCGCTGATCCGGCGCGGGG Look for more occurrences |
| Start | 40360 |
| End | 40382 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. PAMC 25886 ctg7180000004544, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGTGCACCTGCATGA(5' tail) CCTCGCGCTG(5' stem) ATC(loop) CGGCGCGGGG(3' stem) TTATGCCCGTCGCCA(3' tail). Confidence: 95. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|