| Internal ID | 17756108 | Source Database | TransTermHP TERM 3 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 3
|
| Sequence |
GACCCCGCTTTTTAGGCGGGGTC Look for more occurrences |
| Start | 7156 |
| End | 7178 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. PAMC 25886 ctg7180000004522, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ACCGCACACAAAAAA(5' tail) GACCCCGCCT(5' stem) AAA(loop) AAGCGGGGTC(3' stem) TTTTTTCGTGCGGCC(3' tail). Confidence: 100. opp_overlap 7156 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|