| Internal ID | 17755724 | Source Database | TransTermHP TERM 13 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 13
|
| Sequence |
GGGAGGCCTGCAGAGGCCTCCC Look for more occurrences |
| Start | 41877 |
| End | 41898 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. PAMC 25886 ctg7180000004482, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGCTTGAACAAAAAA(5' tail) GGGAGGCCT(5' stem) GCAG(loop) AGGCCTCCC(3' stem) TTTTTTTATGGCCGC(3' tail). Confidence: 100. opp_overlap 41877 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|