| Internal ID | 17754669 | Source Database | TransTermHP TERM 13 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 13
|
| Sequence |
CGGGGCGGCCTTGGCCGCCCCG Look for more occurrences |
| Start | 38185 |
| End | 38206 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas putida S610 EDP1.NODE_1820, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGACGGTAATGAAAA(5' tail) CGGGGCGGC(5' stem) CTTG(loop) GCCGCCCCG(3' stem) TGCGTTTTGCAGCGG(3' tail). Confidence: 100. opp_overlap 38185, overlap 38182 38181 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|