| Internal ID | 17753535 | Source Database | TransTermHP TERM 212 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 212
|
| Sequence |
GGGCATGGAACTCCATTTCCATGCCC Look for more occurrences |
| Start | 921653 |
| End | 921678 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO579 Contig01, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGGGATAAAAACAAA(5' tail) GGGCATGGAA(5' stem) ATGGAG(loop) TTCCATGCCC(3' stem) TTGTCGGCTGAATGA(3' tail). Confidence: 100. opp_overlap 921653 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|