Internal ID | 17753458 | Source Database | TransTermHP TERM 95 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 95
|
Sequence |
CGCCGACCCTAGGGTCGGCG Look for more occurrences |
Start | 477814 |
End | 477833 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO579 Contig01, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CGCGCCATGCAAGAA(5' tail) CGCCGACC(5' stem) CTAG(loop) GGTCGGCG(3' stem) TTTTTTTATCCTCGC(3' tail). Confidence: 100. opp_overlap 477814 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|