Internal ID | 17744713 | Source Database | TransTermHP TERM 13 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 13
|
Sequence |
CGGGGCGCCAAGGCGCCCCG Look for more occurrences |
Start | 33226 |
End | 33245 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PADK2_CF510 contig002, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCTGAGCCGGACCGA(5' tail) CGGGGCGC(5' stem) CAAG(loop) GCGCCCCG(3' stem) TTTCGTTTCCGCCGT(3' tail). Confidence: 95. |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|