| Internal ID | 17743694 | Source Database | TransTermHP TERM 1381 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1381
|
| Sequence |
GCCCCGGCCAAGCGCCGGGGC Look for more occurrences |
| Start | 5700229 |
| End | 5700249 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa 19BR 19BR chromosome, whole genome shotgun sequence, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TCCCGTCCCAGGAAA(5' tail) GCCCCGGC(5' stem) CAAGC(loop) GCCGGGGC(3' stem) TTTTCGCTCCTACCC(3' tail). Confidence: 100. opp_overlap 5700229 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|