Internal ID | 17742676 | Source Database | TransTermHP TERM 1430 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1430
|
Sequence |
CGGGGCGCCAAGGCGCCCCG Look for more occurrences |
Start | 5737449 |
End | 5737468 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa 213BR 213BR chromosome, whole genome shotgun sequence, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCTGAGCCGGACCGA(5' tail) CGGGGCGC(5' stem) CAAG(loop) GCGCCCCG(3' stem) TTTCGTTTCCGCCGT(3' tail). Confidence: 100. |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|