Internal ID | 17742183 | Source Database | TransTermHP TERM 644 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 644
|
Sequence |
GCCCGGCCAGCGAGCCGGGC Look for more occurrences |
Start | 2884547 |
End | 2884566 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa 213BR 213BR chromosome, whole genome shotgun sequence, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CGCGCCCACGAAAAA(5' tail) GCCCGGC(5' stem) TCGCTG(loop) GCCGGGC(3' stem) TCTTTCGCTGCGGGT(3' tail). Confidence: 100. opp_overlap 2884547 2884545, overlap 2884531 2884532 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|