| Internal ID | 17741336 | Source Database | TransTermHP TERM 1019 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1019
|
| Sequence |
CAAGCCCCGCAATTGGCGGGGCTTCG Look for more occurrences |
| Start | 4266431 |
| End | 4266456 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa 9BR 9BRScaffold1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGCCCACACCGCAAG(5' tail) C-AAGCCCCGC(5' stem) AATTG(loop) GCGGGGCTTCG(3' stem) TTTTTCCGGGGGCCA(3' tail). Confidence: 95. gap 1, opp_overlap 4266434, overlap 4266434 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|