| Internal ID | 17740664 | Source Database | TransTermHP TERM 1616 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1616
|
| Sequence |
TTGGTCACCAGCGGTTACCGA Look for more occurrences |
| Start | 6008735 |
| End | 6008755 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens R124 chromosome, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GTCGCCGTAAAAAAA(5' tail) TCGGTAACC(5' stem) GCT(loop) GGTGACCAA(3' stem) CGGTTTACGCCCCTT(3' tail). Confidence: 95. opp_overlap 6008742, overlap 6008736 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|