| Internal ID | 17740513 | Source Database | TransTermHP TERM 1403 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1403
|
| Sequence |
CGGAGCGTGCGAACGCTCCG Look for more occurrences |
| Start | 5258896 |
| End | 5258915 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens R124 chromosome, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GACCTGAACGAAAAA(5' tail) CGGAGCGT(5' stem) GCGA(loop) ACGCTCCG(3' stem) TTTTTGTTTCTGCCT(3' tail). Confidence: 100. opp_overlap 5258896, overlap 5258886 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|