| Internal ID | 17740317 | Source Database | TransTermHP TERM 1128 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1128
|
| Sequence |
GCCGACCCATTTTTTGGGTCGGC Look for more occurrences |
| Start | 4359059 |
| End | 4359081 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens R124 chromosome, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGGGATTGTTATCAA(5' tail) GCCGACCCA(5' stem) TTTTT(loop) TGGGTCGGC(3' stem) TTTTTTATGGCCGGT(3' tail). Confidence: 100. opp_overlap 4359059, overlap 4359077 4359078 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|