| Internal ID | 17739883 | Source Database | TransTermHP TERM 445 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 445
|
| Sequence |
GGTCAGAGCCTCACGGCTCTGGCC Look for more occurrences |
| Start | 1510120 |
| End | 1510143 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens R124 chromosome, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGAAAGTTTTTTATA(5' tail) GGTCAGAGCC(5' stem) TCAC(loop) GGCTCTGGCC(3' stem) TTGTCTGTTGTTCCC(3' tail). Confidence: 95. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|