| Internal ID | 17735735 | Source Database | TransTermHP TERM 27 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 27
|
| Sequence |
CGAAGCCGGCATTTGCCGGCTTCG Look for more occurrences |
| Start | 94017 |
| End | 94040 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas stutzeri NF13 contig00040, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTTGCCTGAACGAAG(5' tail) CGAAGCCGGC(5' stem) ATTT(loop) GCCGGCTTCG(3' stem) TCGTTTCTGTTTTTC(3' tail). Confidence: 100. opp_overlap 94017 94016, overlap 94016 94012 94007 94021 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|