| Internal ID | 17733358 | Source Database | TransTermHP TERM 24 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 24
|
| Sequence |
GGCGAGGTGCCCCGCGCCTCGCC Look for more occurrences |
| Start | 88002 |
| End | 88024 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. M47T1 contig04, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GAGTAAACCTTGTGT(5' tail) GGCGAGGTGC(5' stem) CCC(loop) GCGCCTCGCC(3' stem) TTTTTCCCTCCGGAA(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|