| Internal ID | 17732441 | Source Database | TransTermHP TERM 114 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 114
|
| Sequence |
GGCCTGCTTTCATGCAGGCC Look for more occurrences |
| Start | 389335 |
| End | 389354 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas alcaliphila 34 IC, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ACCATCTAATATCAG(5' tail) GGCCTGC(5' stem) TTTCAT(loop) GCAGGCC(3' stem) TTTTTTGTTTTTGCT(3' tail). Confidence: 100. opp_overlap 389334 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|