| Internal ID | 17731878 |
| Source Database | TransTermHP TERM 16 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 16
|
| Sequence |
GCTGCTCCCTCACCGGGAGCAGC Look for more occurrences |
| Start | 31443 |
| End | 31465 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas stutzeri MF28 contig25, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CATCTACCGAAGAAA(5' tail) GCTGCTCCC(5' stem) TCACC(loop) GGGAGCAGC(3' stem) TTTTTTTTTTCGTTT(3' tail). Confidence: 100. opp_overlap 31443 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|