| Internal ID | 17723154 | Source Database | TransTermHP TERM 1193 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1193
|
| Sequence |
CGCCCAGCACGCGCTGGGCG Look for more occurrences |
| Start | 5808458 |
| End | 5808477 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas syringae pv. syringae B64 chromosome, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTGCGCAACGAAAAA(5' tail) CGCCCAGC(5' stem) GCGT(loop) GCTGGGCG(3' stem) TTTTTCTCGCAGGCA(3' tail). Confidence: 100. opp_overlap 5808458 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|