| Internal ID | 17705076 | Source Database | TransTermHP TERM 276 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 276
|
| Sequence |
CCCGCGTACCCGCAAGGGACGCGGG Look for more occurrences |
| Start | 1408014 |
| End | 1408038 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa NCAIM B.001380 K260DRAFT_scf7180000000062_quiver.15_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CCGGGCATGAAAAAA(5' tail) CCCGCGT-CCC(5' stem) TTGC(loop) GGGTACGCGGG(3' stem) CCTCTGCCTCGACGC(3' tail). Confidence: 100. gap 1, opp_overlap 1407972 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|