| Internal ID | 17704874 | Source Database | TransTermHP TERM 70 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 70
|
| Sequence |
CGCCGCATATGATATGCGGCG Look for more occurrences |
| Start | 415706 |
| End | 415726 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa NCAIM B.001380 K260DRAFT_scf7180000000064_quiver.13_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGTACCCTGTCCTTG(5' tail) CGCCGCATA(5' stem) TGA(loop) TATGCGGCG(3' stem) TTTTTTTTGCCTTCC(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|