Internal ID | 17704512 | Source Database | TransTermHP TERM 9 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 9
|
Sequence |
GAAAGCCCGCGAAAGCGGGCTTTC Look for more occurrences |
Start | 41312 |
End | 41335 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas plecoglossicida NBRC 103162 = DSM 15088 Q378DRAFT_scaffold00012.12_C, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | AGAAACCGCTCGAAA(5' tail) GAAAGCCCGC(5' stem) GAAA(loop) GCGGGCTTTC(3' stem) TTTGGCTGCAGATCC(3' tail). Confidence: 95. opp_overlap 41302 41312 41316, overlap 41316 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|