| Internal ID | 17703826 | Source Database | TransTermHP TERM 8 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 8
|
| Sequence |
CTGGGGCCGCCGCGAAGCGGCCCCAG Look for more occurrences |
| Start | 41976 |
| End | 42001 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas mosselii DSM 17497 Q380DRAFT_scaffold00021.21_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TAAGGATCGTCGTCA(5' tail) CTGGGGCCGC(5' stem) CGCGAA(loop) GCGGCCCCAG(3' stem) TCGTTTTGTGCTTCA(3' tail). Confidence: 93. overlap 41974 41974 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|