| Internal ID | 17703386 | Source Database | TransTermHP TERM 81 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 81
|
| Sequence |
CAGGGCGACCCACGCGGGTCGCCCTG Look for more occurrences |
| Start | 261711 |
| End | 261736 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas mosselii DSM 17497 Q380DRAFT_scaffold00004.4_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGTCACAGACGAAAA(5' tail) CAGGGCGACCC(5' stem) GCGT(loop) GGGTCGCCCTG(3' stem) CTGCACCCTGACGAG(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|