| Internal ID | 17702701 | Source Database | TransTermHP TERM 30 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 30
|
| Sequence |
CGCCCGGGCGACTTCGCCTGGGCG Look for more occurrences |
| Start | 218298 |
| End | 218321 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas fulva NBRC 16637 = DSM 17717 Q382DRAFT_scaffold00001.1_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ACTCAGATACAAAAA(5' tail) CGCCCAGGCG(5' stem) AAGT(loop) CGCCCGGGCG(3' stem) TTTGACGGGGCGGTA(3' tail). Confidence: 100. opp_overlap 218298 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|